View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_low_24 (Length: 287)
Name: NF20654_low_24
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_low_24 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 3 - 287
Target Start/End: Complemental strand, 45371201 - 45370918
Alignment:
| Q |
3 |
catgtcgaagaatatagtcgcaaaagggaattgtgtcagaagaataaccatatctcacctttaccaacaaacacactattttcccttacaaccaaaaaga |
102 |
Q |
| |
|
|||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45371201 |
catgtccaacaacatagtcgcaaaagggaattgtgtcagaagaataaccatatctcacctttaccaacaaacacactattttcccttagaaccaaaaaga |
45371102 |
T |
 |
| Q |
103 |
gacacaatattttcannnnnnnnctctttaccaaagccaaaggtagctagaaaaagcagggcatgaaataattcaacttcctannnnnnnnctctctgat |
202 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
45371101 |
gacacaacattttcattttttttctctttaccaaagccaaaggtagctagaaaaagcagggcatgaaataattcaacttcctatttttttt-tttctgat |
45371003 |
T |
 |
| Q |
203 |
aaatcactcaattatttgtcactgcacacaacgttacaagaaacaatcatctctcggtatatctttctgcagatgagcaaatcac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45371002 |
aaatcactcaattatttgtcactgcacacaacgttacaagaaacaatcatctctcggtatatctttctgcagatgagcaaatcac |
45370918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University