View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_low_26 (Length: 285)
Name: NF20654_low_26
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 268
Target Start/End: Complemental strand, 3415237 - 3414989
Alignment:
| Q |
20 |
aacgaggtaacccgcgaggtgcccaaattgaagaaatattattgacattaggcaggtgatgtgctttatttttgtctatgtgtacttctagagacctcct |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415237 |
aacgcggtaacccgcgaggtgcccaaattgaagaaatattattgacattaggcaggtgatgtgctttatttttgtctatgtgtacttctagagacctcct |
3415138 |
T |
 |
| Q |
120 |
taataatatttgcttttgaaaattgatattcattgtcctcctgctcttgatcttctttaattatttgttcttcttaaaaatacaattcttaaattggata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415137 |
taataatatttgcttttgaaaattgatattcattgtcctcctgctcttgatcttctttaattatttgttcttcttaaaaatacaattcttaaattggata |
3415038 |
T |
 |
| Q |
220 |
aaatggttagacattttgacctagtagcaatatgaagtgaagtataatt |
268 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3415037 |
aaatggttagacattttgacctggtagcaatatgaagtgaagtataatt |
3414989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University