View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_low_38 (Length: 239)
Name: NF20654_low_38
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 224
Target Start/End: Complemental strand, 28232897 - 28232679
Alignment:
| Q |
6 |
aagctcataccggtgattgcgaacactagattctttgcatgaaaatattaagtttgcttcccaactagtaacttaagatgggaaacagattacaaaagtc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232897 |
aagctcataccggtgattgcgaacactagattctttgcatgaaaatattaagtttgcttccctactagtaacttaagatgggaaacagattacaaaagtc |
28232798 |
T |
|
| Q |
106 |
cctatttcaaggaaatcatgctggtcaaacactacgaagcattgatacagaaataaacacgacactaacacgtaaactccaataataaattacgaaagta |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232797 |
cctatttcaaggaaatcatgttggtcaaacactatgaagcattgatacagaaacaaacacgacactaacacgtaaactccaataataaattacgaaagtt |
28232698 |
T |
|
| Q |
206 |
gaggcaattaacagcatag |
224 |
Q |
| |
|
|| ||||||||| |||||| |
|
|
| T |
28232697 |
gaagcaattaacggcatag |
28232679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 134
Target Start/End: Complemental strand, 4745703 - 4745609
Alignment:
| Q |
39 |
tttgcatgaaaatattaagtttgcttcccaactagtaacttaagatgggaaacagattacaaaagtccctatttcaaggaaatcatgctggtcaaa |
134 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||| |||||||||| || ||| ||||||||||||||||| | || || |||||||| |
|
|
| T |
4745703 |
tttgcatcaaaatattaaatttgcttccgaactagtaacttgtgatgggaaaccgactac-gaagtccctatttcaaggcattcttggtggtcaaa |
4745609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 28240412 - 28240303
Alignment:
| Q |
39 |
tttgcatgaaaatattaagtttgcttcccaactagtaacttaagatgggaaacagattacaaaagtccctatttcaaggaaatcatgctggtcaaacact |
138 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| ||||| ||||||||| | ||| ||||||||||||| |||| |||| | |||||||| || |
|
|
| T |
28240412 |
tttgcatgaaaatattaagtttgcttcacgactag-aacttctgatgggaaagtaactac-aaagtccctatttaaaggcaatctttgtggtcaaatgct |
28240315 |
T |
|
| Q |
139 |
acgaagcattga |
150 |
Q |
| |
|
| |||||||||| |
|
|
| T |
28240314 |
atgaagcattga |
28240303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University