View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_low_41 (Length: 214)
Name: NF20654_low_41
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 38940195 - 38940281
Alignment:
| Q |
1 |
tctttttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940195 |
tctttttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
38940281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 38940347 - 38940396
Alignment:
| Q |
153 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940347 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt |
38940396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 38940166 - 38940194
Alignment:
| Q |
1 |
tctttttcactcactgatgaatcttcgtt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38940166 |
tctttttcactcactgatgaatcttcgtt |
38940194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University