View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20654_low_41 (Length: 214)

Name: NF20654_low_41
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20654_low_41
NF20654_low_41
[»] chr2 (3 HSPs)
chr2 (1-87)||(38940195-38940281)
chr2 (153-202)||(38940347-38940396)
chr2 (1-29)||(38940166-38940194)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 38940195 - 38940281
Alignment:
1 tctttttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc 87  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38940195 tctttttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc 38940281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 38940347 - 38940396
Alignment:
153 gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
38940347 gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt 38940396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 38940166 - 38940194
Alignment:
1 tctttttcactcactgatgaatcttcgtt 29  Q
    |||||||||||||||||||||||||||||    
38940166 tctttttcactcactgatgaatcttcgtt 38940194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University