View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_low_5 (Length: 610)
Name: NF20654_low_5
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 565; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 565; E-Value: 0
Query Start/End: Original strand, 4 - 604
Target Start/End: Complemental strand, 28774941 - 28774341
Alignment:
| Q |
4 |
tggtttgagtagagggaagatttctcactgctttctctatgagtggaggtgggatcctattaactgtttatacaggtaaggagtgggtgaggaggggtac |
103 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28774941 |
tggtttgagtggagggaagatttctcactgctttctctatgagtggaggtgggatcctattaactgtttatacaggtaaggagtgggcgaggaggggtac |
28774842 |
T |
 |
| Q |
104 |
attctagttggtgtccatggcaaagagttttctggtcgctgctgtcagtctatgtgaggcctgctttgggcttagttgttattctggttgattgtgtcct |
203 |
Q |
| |
|
||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28774841 |
attttggttggtgtccatggcgaagagttttctggtcgctgctgtcagtctatgtgaggcctgctttgggcttagttgttattctggttgattgtgtcct |
28774742 |
T |
 |
| Q |
204 |
gctgatgctgacacaaagcttccaattctgtgtgttttgcttctagtgctgcttttggtttgagtttctgcagttgtttttccggatgcaggacactgta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28774741 |
gctgatgctgacacaaagcttccaattctgtgtgttttgcttctagtgctgcttttggtttgagtttctgtagttgtttttccggatgcaggacactgta |
28774642 |
T |
 |
| Q |
304 |
gttttctctagttcttaagtgtagcaggttggtagtttgtaggtgtgatttatggcagtgtacacactgtagtgccgttggggccttactttagtgcagg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28774641 |
gttttctctagttcttaagtgtagcaggttggtaatttgtaggtgtgatttatggcagtgtacacactgtagtgccgttggggccttactttagtgcagg |
28774542 |
T |
 |
| Q |
404 |
accgtttcagttttggttctgtggtagtattatttgacggcagtttttgaggcctgtcttctgccgcctttttatggtgtaaaggggaaaatttaggatt |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28774541 |
accgtttcagttttggttctgtggtagtattatttgacggcagtttttgaggcctgtcttctgccgcctttttatggtgtaaaggggaaaatttaggatt |
28774442 |
T |
 |
| Q |
504 |
ctggtgccgcctgctgctagagttgatgttcagatgcagagttgtgtgcttctggtctgcagctttggtgcattatagtgtccctcggttgttctgtgct |
603 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
28774441 |
ctggtgccgcctgctgctagagttgatgttcagatgcagagttgtgtgcttctggtctgcagctttggtgcattatagtgtccctaggttgttctgggct |
28774342 |
T |
 |
| Q |
604 |
g |
604 |
Q |
| |
|
| |
|
|
| T |
28774341 |
g |
28774341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University