View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20656_high_22 (Length: 206)
Name: NF20656_high_22
Description: NF20656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20656_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 44937157 - 44936989
Alignment:
| Q |
19 |
agtattaactatataatgtatcacaagagaaaatttgtttgtaaaagaatgtagttggattggttatcagacaaacatttctatttataggataattttg |
118 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44937157 |
agtattaacgatataatgtatcacaagaaaaaatttgtttgtaaaagaatgtagttggattggttatcagacaaacatttctatttataggataattttg |
44937058 |
T |
 |
| Q |
119 |
aacatatgatgttaatgatgtagtgactagcactgaagtttgacgaatttctacatgcttttaggagta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44937057 |
aacatatgatgttaatgatgtagtgactagcactaaagtttgacgaatttctacatgcttttaggagta |
44936989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University