View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20656_low_2 (Length: 493)
Name: NF20656_low_2
Description: NF20656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20656_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 16 - 281
Target Start/End: Original strand, 2501149 - 2501416
Alignment:
| Q |
16 |
tggggactcaattgaatgtcaggattctttgtcacggaaaaaattggtgttttgatttattgaattcaataatgagagctactctactctactgtccgcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
2501149 |
tggggactcaattgaatgtcaggattctttgtcacggaaaaaattggtgttttgagtcattgaattcaataatgaaagctactctactctactgtcctcc |
2501248 |
T |
 |
| Q |
116 |
aatatttactct--ccgtatttatctgaccgctttcacatgactaccctgcaaccaagcataccgacaaacacactgtactactctgtattttcatttca |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2501249 |
aatatttactctctccgtatttatctgaccgctttcacatgactaccctgcaaccaagcatactgacaaacacactgtactactctgaattttcatttca |
2501348 |
T |
 |
| Q |
214 |
ttattcaaatttcaataaattttcttctgtcacacccttcactattgcattccccatccaaaataata |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501349 |
ttattcaaatttcaataaattttcttctgtcacacccttcactattgcattccccatccaaaataata |
2501416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 344 - 477
Target Start/End: Original strand, 2501479 - 2501612
Alignment:
| Q |
344 |
actatactatactggctctcccaacgatggaagcttttagcttgctcaaatactggcgaggtggtggtgctgttgttggtctctctccttcttctgactc |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501479 |
actatactatactggctctcccaacgatggaagcttttagcttgctcaaatactggcgaggtggtggtgctgttgttggtctctctccttcttctgactc |
2501578 |
T |
 |
| Q |
444 |
cacaactaccaccaccgttaacaccactactatc |
477 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2501579 |
cacaaccaccaccaacgttaacaccactactatc |
2501612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University