View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20657_low_3 (Length: 245)

Name: NF20657_low_3
Description: NF20657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20657_low_3
NF20657_low_3
[»] chr3 (2 HSPs)
chr3 (1-221)||(44839978-44840198)
chr3 (1-208)||(44851751-44851958)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44840198 - 44839978
Alignment:
1 agctggaagagctgctggaaaccttcgacggacaccaaatactggttatatgagacctgctggtagaggctatggaaggccccatccaggtacaggtgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44840198 agctggaagagctgctggaaaccttcgacggacaccaaatactggttatatgagacctgctggtagaggctatggaaggccccatccaggtacaggtgga 44840099  T
101 tatggatacaatgggacttctaatcctatcattcgtcctcctccggagggtgtctgcaaccggaaatcaatgcatgtaagggatgaaattgtaccagagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44840098 tatggatacaatgggacttctaatcctatcattcgtcctcctccggagggtgtctgcaaccggaaatcaatgcatgtaagggatgaaattgtaccagagg 44839999  T
201 agtttgaatttgaacagaaga 221  Q
    |||||||||||||||||||||    
44839998 agtttgaatttgaacagaaga 44839978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 44851958 - 44851751
Alignment:
1 agctggaagagctgctggaaaccttcgacggacaccaaatactggttatatgagacctgctggtagaggctatggaaggccccatccaggtacaggtgga 100  Q
    |||||||||||||||||||||||   | | |||||||||| |||||||||||||||| |||||||||||| ||||||||||||| ||||  || ||||||    
44851958 agctggaagagctgctggaaacccctggcagacaccaaatgctggttatatgagacccgctggtagaggcaatggaaggccccagccagccactggtgga 44851859  T
101 tatggatacaatgggacttctaatcctatcattcgtcctcctccggagggtgtctgcaaccggaaatcaatgcatgtaagggatgaaattgtaccagagg 200  Q
    ||||||||||||| |||||||||||| ||||||| ||||||||   |||||| ||| ||| |||||||||  |||| |||| ||||||||||||||||||    
44851858 tatggatacaatgtgacttctaatcccatcattcctcctcctctacagggtggctggaactggaaatcaactcatgcaaggaatgaaattgtaccagagg 44851759  T
201 agtttgaa 208  Q
    ||||||||    
44851758 agtttgaa 44851751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University