View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20658_high_9 (Length: 218)
Name: NF20658_high_9
Description: NF20658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20658_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 39813502 - 39813688
Alignment:
| Q |
18 |
ggtattacggtgcatttgccaaatcaaggtggctcaccgtgattctgataaactcaccgtgaatcaaaacatgctgtaacacttagaaattgattgaaat |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39813502 |
ggtattacggtccatttgccaaatcaaggtggctcaccgtgattctgataaactcaccgtgaatcaaaacatgctgtaacacttagaaattgattgaaat |
39813601 |
T |
 |
| Q |
118 |
tgttctataaattgttcgttttaggcaaggaaggttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39813602 |
tgttctataaattgttcgttttaggcaaggaaggttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
39813688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 15801849 - 15801902
Alignment:
| Q |
151 |
gttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
204 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||| ||||| || ||||||||| |
|
|
| T |
15801849 |
gttgatgacttgaggcagaagcttcgcatgcgaggcctacgatgtcatcctatg |
15801902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 32 - 73
Target Start/End: Complemental strand, 38425383 - 38425342
Alignment:
| Q |
32 |
tttgccaaatcaaggtggctcaccgtgattctgataaactca |
73 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
38425383 |
tttgccaaatcacggtggctcaacgtgattctgacaaactca |
38425342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University