View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20658_low_4 (Length: 381)
Name: NF20658_low_4
Description: NF20658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20658_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 49171366 - 49171496
Alignment:
| Q |
1 |
ttgcaaaattttctgtctctgtgggtcgtattgaatttgaaatgctttctctttctgtgcaaaacttcaattttaactcacttgtattactatgcatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49171366 |
ttgcaaaattttctgtctctgtgggtcgtattgaatttgaaatgctttctttttctgtgcaaaacttcaattttaactcacttgtattactatccatgaa |
49171465 |
T |
|
| Q |
101 |
tgactaaaaataagtccaaagtagaatgatg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49171466 |
tgactaaaaataagtccaaagtagaatgatg |
49171496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 171 - 250
Target Start/End: Original strand, 49171536 - 49171615
Alignment:
| Q |
171 |
ggaagctaatggttcaattttgaccttttgagtttgttttaacatgaacttgaccttttgagcttattttaagtggcatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
49171536 |
ggaagctaatggttcaattttgaccttttgagtttgttttaacatgaaattgacctattgagcttattttaagtggcatg |
49171615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University