View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2065_high_10 (Length: 217)
Name: NF2065_high_10
Description: NF2065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2065_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 22 - 198
Target Start/End: Complemental strand, 8572450 - 8572274
Alignment:
| Q |
22 |
ataggaaaatgatgaaaccttacaaaacacacatactatcatcttatctcttgtagtaccatgctggtcatggtgggtcaacccgccaattttgctaaca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8572450 |
ataggaaaatgatgaaaccttacaaaacacacatactatcatcttatctcttgtagtactatgctggtcatggtgggtcaacccgccaattttgttaaca |
8572351 |
T |
 |
| Q |
122 |
tggatggatccacccagatctaccagcttcacttgttatatcaattagtattttattcatatagtatatggagatgg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8572350 |
tggatggatccacccagatctaccagcttcacttgttatatcaattagtattttattcatatagtatatggagatgg |
8572274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University