View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2065_high_5 (Length: 254)
Name: NF2065_high_5
Description: NF2065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2065_high_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 35973630 - 35973883
Alignment:
| Q |
1 |
atcttaccggaacaacgtccttccggtgacggaaggtcttcctagacaaccaccgaagttgcttttgaaagtgacggttcttggaagccttggtcccgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35973630 |
atcttaccggaacaacgtccttccggtgacggaaggtcttcctagacaaccaccgaagttgcttttgaaagtgacggttcttggaagccttggtcctatt |
35973729 |
T |
|
| Q |
101 |
cagatgctgatgaagccggaatcaactgtcggcgatctagtggaaaccgccgtgcggcagtatatcaatgaagctcgccgtccaatcctgccttcaagat |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973730 |
cagatgctgatgaaaccggaatcaactgtcggcgatctagtggaaaccgccgtgcggcagtatatcaatgaagctcgccgtccaatcctgccttcaagat |
35973829 |
T |
|
| Q |
201 |
ttggctcggattttgaacttcacttttcacaatttagcctagaaagtaagtctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973830 |
ttggctcggattttgaacttcacttttcacaatttagcctagaaagtaagtctt |
35973883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University