View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2065_low_10 (Length: 241)
Name: NF2065_low_10
Description: NF2065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2065_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 47425797 - 47425598
Alignment:
| Q |
16 |
attatactgctgatgtgatttttgtttggtgttgttgtggagtagtgatttaatacattgcaggggtaatatgtctttgaatgtgaggggttggttaggg |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425797 |
attatactcctgatgtgatttttgtttggtgttgttgtggagtagtgatttaatacattgcaggggtaatatgtctttgaatgtgaggggttggttaggg |
47425698 |
T |
 |
| Q |
116 |
gctttatattcaccaccctacgatgtttttctatttttggcttgatgttcttgcaatttgtttaagccatgggtccatggcctttactgggctaaaacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425697 |
gctttatattcaccaccctacgatgtttttctatttttggcttgatgttcttgcaa-ttgtttaagccatgggtccatggcctttactgggctaaaacaa |
47425599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University