View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2065_low_14 (Length: 217)

Name: NF2065_low_14
Description: NF2065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2065_low_14
NF2065_low_14
[»] chr1 (1 HSPs)
chr1 (22-198)||(8572274-8572450)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 22 - 198
Target Start/End: Complemental strand, 8572450 - 8572274
Alignment:
22 ataggaaaatgatgaaaccttacaaaacacacatactatcatcttatctcttgtagtaccatgctggtcatggtgggtcaacccgccaattttgctaaca 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||    
8572450 ataggaaaatgatgaaaccttacaaaacacacatactatcatcttatctcttgtagtactatgctggtcatggtgggtcaacccgccaattttgttaaca 8572351  T
122 tggatggatccacccagatctaccagcttcacttgttatatcaattagtattttattcatatagtatatggagatgg 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8572350 tggatggatccacccagatctaccagcttcacttgttatatcaattagtattttattcatatagtatatggagatgg 8572274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University