View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20660_high_10 (Length: 276)
Name: NF20660_high_10
Description: NF20660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20660_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 46720476 - 46720297
Alignment:
| Q |
22 |
gtactcttacaaatccaaataaaacatactttgaaggttcggttaataactataagagctcatttcaatttgtcttttatggtagtgtaggtattttgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46720476 |
gtactcttacaaatccaaataaaacatactttgatggttcggttaataactataagagctcatttcaatttgtcttttatggtagtgtaggtattttgaa |
46720377 |
T |
 |
| Q |
122 |
tgtgcttcatactaagttcaaagctttgttggcaagcaggtttcaaaaagttgttatgttttttagactttttgcatgtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46720376 |
tgtgcttcatactaagttcaaagctttgttggcaagcaggtttcaaaaagttgttatgttttttagactttttgcatgtt |
46720297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 198 - 264
Target Start/End: Complemental strand, 46719943 - 46719877
Alignment:
| Q |
198 |
tgttgtgtagttggtgacgataagtccagataaatttcatcattatgtcaatcttttggtggatatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46719943 |
tgttgtgtagttggtgacgataagtccagataaatttcatcattatgtcaatcttttggtggatatt |
46719877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University