View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20660_low_10 (Length: 281)
Name: NF20660_low_10
Description: NF20660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20660_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 33782168 - 33781907
Alignment:
| Q |
15 |
ctcaacttctagcaaggggtagttgtggaagaaacgagcagattctttttggggcttgggcttgggccttaggtcagtgattatgagagaagaagggtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33782168 |
ctcaacttctagcaaggggtagttgtggaagaaacgagcagattctttttggggcttgggcttgggccttaggtcagtgattataagagaagaagggtga |
33782069 |
T |
|
| Q |
115 |
aaggacccattattattgttatgatgatga---------aaattatggagaggcttggttgatcttcttgcagcagctctctctagcttgtgtgcgttct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782068 |
aaggacccattattattgttatgatgatgatgatgatgaaaattatggagaggcttggttgatcttcttgcagcagctctctctagcttgtgtgcgttct |
33781969 |
T |
|
| Q |
206 |
ggtggccaccaagagcttgagaagagtagaacttgcggtggcagaagtggcactgaaaagtg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781968 |
ggtggccaccaagagcttgagaagagtagaacttgcggtggcagaagtggcactgaaaagtg |
33781907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 245
Target Start/End: Original strand, 31980035 - 31980105
Alignment:
| Q |
175 |
gcagcagctctctctagcttgtgtgcgttctggtggccaccaagagcttgagaagagtagaacttgcggtg |
245 |
Q |
| |
|
||||||||||| ||| | ||||| || || ||||| ||||||||||||||||||| |||||| || ||||| |
|
|
| T |
31980035 |
gcagcagctctttcttgtttgtgagcattttggtgaccaccaagagcttgagaagtgtagaattttcggtg |
31980105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University