View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20660_low_13 (Length: 242)
Name: NF20660_low_13
Description: NF20660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20660_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 48 - 225
Target Start/End: Original strand, 47120717 - 47120893
Alignment:
| Q |
48 |
atactttatcctaggtgcttataattgtaacattgaaatttagaagaaataatctcacatgaattttggttaaattagatatgtaactggcttaactctc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
47120717 |
atactttatcctaggtgcttataattgtaacattgaaatttagaagaaataatctcacatgaattttggttaaattagatatgtaaccggcttaactc-c |
47120815 |
T |
|
| Q |
148 |
ccctttgaaacattggttattataacatcaattttttcttcatacttagaggtggttatgttttgcatacaccttttt |
225 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120816 |
ccccttgaaacattggttattataacatcaattttttcttcatacttagaggtggttatgttttgcatacaccttttt |
47120893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University