View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_high_12 (Length: 385)
Name: NF20661_high_12
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 31504074 - 31504264
Alignment:
| Q |
1 |
actacttatgaacatgaatcttgatgaagtatattatacatcaacacaaagaatgtacttatataaatattttgtgtgttgaccaataatacatagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31504074 |
actacttatgaacatgaatcttgatgaagtatattatacatcaacacaaagaatgtacttatataaatattttgtgtgttgaccaataatacatagatga |
31504173 |
T |
 |
| Q |
101 |
ctagatgagcgaagtttatgtactttttgtctctttcattcatcttatcctactcacttctctgtcactctctacaacctgcacgcgccac |
191 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31504174 |
ccagatgagcgaagtttatgtactttttgtctctttcattcatcttatcctactcacttctctgtcactctctacaacctgcacgcgccac |
31504264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 251 - 374
Target Start/End: Original strand, 31504325 - 31504448
Alignment:
| Q |
251 |
gcagtatcataagttgctttcatgctcagtgctgtcgtgagtagcaccagaggtttttgcagggtttgttttggattacattattgtaccttgttacctt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31504325 |
gcagtatcataagttgctttcatgctcagtgctgtcgtgagtagcaccagaggtttttgcagggtttgttttggattacattattgtaccttgttacctt |
31504424 |
T |
 |
| Q |
351 |
aaagaactagtttttgggattctt |
374 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31504425 |
aaagaactagtttttgggattctt |
31504448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University