View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_high_25 (Length: 260)
Name: NF20661_high_25
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 250
Target Start/End: Complemental strand, 34857376 - 34857146
Alignment:
| Q |
20 |
ttttctgatgttagatgaaggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857376 |
ttttctgatgttagatgaaggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggac |
34857277 |
T |
 |
| Q |
120 |
aactttttcctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactatta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857276 |
aactttttcctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactatta |
34857177 |
T |
 |
| Q |
220 |
aagttggtaactgttatgcagcctacctatg |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
34857176 |
aagtttgtaactgttatgcagcctacctatg |
34857146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University