View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_high_26 (Length: 259)
Name: NF20661_high_26
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 44490008 - 44490229
Alignment:
| Q |
19 |
agctagaaatgcaaagaatggaaggagaaagaaaattgagaatgtagtagcaatagagaaggctttccaacccattgttataaaggacatgcaatattgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490008 |
agctagaaatgcaaagaatggaaggagaaagaaaattgagaatgtagtagcaatagagaaggctttccaacccattgttataaaggacatgcaatattgc |
44490107 |
T |
 |
| Q |
119 |
aatatagaaagagagctagctagatttcaaaatttatatatgtagtggttggttggggtttgtgttggatttgagttcaattcgtgcaacacatgactat |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490108 |
aatatagaaagagagctatctagatttcaaattttatatatgtagtggttggttggggtttgtgttggatttgagttcaattcgtgcaacacatgac--- |
44490204 |
T |
 |
| Q |
219 |
agtataggtgattctattatggtgaat |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44490205 |
--tataggtgattctattatggtgaat |
44490229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University