View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_low_14 (Length: 337)
Name: NF20661_low_14
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 37972893 - 37972563
Alignment:
| Q |
1 |
tatgtaatgtagggttatttcaaagtactaatttctgaatattatcggttgacataggctgcgcagttgcaattcagaggacagcgcatttggttggctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37972893 |
tatgtaatgtagggttatttcaaagtactaatttctgaatattatcggttgacataggctgcgcagttgcaattcagaggacagcgcatttggttggctg |
37972794 |
T |
 |
| Q |
101 |
cagtggaggatttgatgtcaaaaggaatgcgttttgccaagcaggttgtacacatacatgcgcgagtgctcattgctgcttaagtaatctttcttctcgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
37972793 |
cagtggaggatttgatgtcaaaaggaatgcgttttgccaagcaggttgtacacatacatgcgcgcatgcacattgctgcttaagtaatctttcttctcgt |
37972694 |
T |
 |
| Q |
201 |
gttatttacaactttgtttccttcaggctcttctttctggatgctcagctggtggtcttgctactattttacactgcgatgaatttcgaggtcatttccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37972693 |
gttatttacaactttgtttccttcaggctcttctttctggatgctcagctggtggtcttgctactattttacactgcgatgaatttcgaggtcatttccc |
37972594 |
T |
 |
| Q |
301 |
aaggactaccaaagtgaagtgcctctgtgat |
331 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
37972593 |
aaggactaccaaagtgaagtgcctcagtgat |
37972563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 227 - 321
Target Start/End: Original strand, 45667633 - 45667727
Alignment:
| Q |
227 |
gctcttctttctggatgctcagctggtggtcttgctactattttacactgcgatgaatttcgaggtcatttcccaaggactaccaaagtgaagtg |
321 |
Q |
| |
|
||||||||||| ||||| || |||||||| || || |||||| |||||||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
45667633 |
gctcttctttccggatgttccgctggtggcctagcaactattatacactgcgatgaatttcgaggtctctttccaaggactactaaagtgaagtg |
45667727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 137
Target Start/End: Original strand, 45667556 - 45667625
Alignment:
| Q |
68 |
tgcaattcagaggacagcgcatttggttggctgcagtggaggatttgatgtcaaaaggaatgcgttttgc |
137 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||| |||| |||||||| ||||| ||||||| |||||| |
|
|
| T |
45667556 |
tgcaatttagaggacagcgtatttgggcagctgcaatggaagatttgatatcaaagggaatgcattttgc |
45667625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University