View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_low_24 (Length: 262)
Name: NF20661_low_24
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 37973051 - 37973296
Alignment:
| Q |
1 |
aacactaacagaggtgtgacctatgaaaaaatgaataaaattggctatcatttcagttttgaagatttaccttatcttcactatccccggtaaaagaggc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37973051 |
aacactaacagaggtgtaacctatgaaaaaatgaataaaattggctatcatttcagttttgaagatttaccttatcttcactatccccggtaaaagaggc |
37973150 |
T |
 |
| Q |
101 |
accatcacagtaacgaattttcactctgttccagttnnnnnnntctgcaatcataaggaacaatatgagccacacagttaagcaaatccttttgagcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37973151 |
accatcacagtaacgaattttcactctgttccagttaaaaaaatctgcaatcataaggaacaatatgagccacacagttaagcaaatccttttgagcata |
37973250 |
T |
 |
| Q |
201 |
attggagtagtccagaaactccaaatagtttcagttgaatgaaaac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37973251 |
attggagtagtccagaaactccaaatagtttcagttgaatgaaaac |
37973296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University