View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_low_28 (Length: 254)
Name: NF20661_low_28
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 19707925 - 19707795
Alignment:
| Q |
1 |
tagattggtaatcactgaaactccatgtgggattgatactatttactactcagtagaaccgtgcacttgcggacctactagcatcctttaactctatgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19707925 |
tagattggtaatcactgaaactccatgtgggattgatactatttactactcagtagaaccaggcacttgcagacctactagcatcctttaactctatgtc |
19707826 |
T |
 |
| Q |
101 |
atatgtcttatgatgtttttgaaaagatctc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19707825 |
atatgtcttatgatgtttttgaaaagatctc |
19707795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 10235277 - 10235345
Alignment:
| Q |
1 |
tagattggtaatcactgaaactccatgtgggattgatactatttactactcagtagaaccgtgcacttg |
69 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||| ||||| |||| ||||||| ||||||||| |
|
|
| T |
10235277 |
tagattggtaatcacttaaactccttatgggattgatactttttacaactcggtagaactgtgcacttg |
10235345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 41700062 - 41699991
Alignment:
| Q |
1 |
tagattggtaatcactgaaactccatgtgggattgatactatttactactcagtagaaccgtgcacttgcgg |
72 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| |||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
41700062 |
tagattggtaatcactaaaactccatgtaggatcgatactttttactactcagtagaaccgtgcatttgcgg |
41699991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 16766054 - 16765984
Alignment:
| Q |
1 |
tagattggtaatcactgaaactccatgtgggattgatactatttactactcagtagaaccgtgcacttgcg |
71 |
Q |
| |
|
|||||||||||||||| ||||||| | |||||| |||| | ||||||| | |||||||| ||||||||||| |
|
|
| T |
16766054 |
tagattggtaatcactaaaactccctatgggatcgatattttttactattaagtagaactgtgcacttgcg |
16765984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University