View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_low_34 (Length: 239)
Name: NF20661_low_34
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_low_34 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 136 - 239
Target Start/End: Original strand, 44490718 - 44490821
Alignment:
| Q |
136 |
attgaatacatcatttttcaatacaaaatttatataaattctctaaggacattctttatcattagtatttttattttactttgaaaagtctaggagggtc |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44490718 |
attgaatacatcatttttcaatataaaatttatataaattctctaaggacattctttatcattagtatttttattttcctttgaaaagtctaggagggtg |
44490817 |
T |
 |
| Q |
236 |
tgtg |
239 |
Q |
| |
|
|||| |
|
|
| T |
44490818 |
tgtg |
44490821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 11 - 117
Target Start/End: Original strand, 44490303 - 44490398
Alignment:
| Q |
11 |
tattattatatcatggcttccatgtaatgtcaatgttggttggtgatcagttgaataacccacctcatgtgaatataatatagaaaaatgcaacatttat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44490303 |
tattattatatcatggcttccatgtaatgtcaatgttggttggtgatcagttgaataacccacctc-----------atatagaaaaatgcaacatttat |
44490391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University