View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20661_low_36 (Length: 215)
Name: NF20661_low_36
Description: NF20661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20661_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 7331411 - 7331611
Alignment:
| Q |
1 |
caaaataaaaacatagaaaagcaaggggggcataaaccaaaactaaagcacaaactatttgaattaataacttggaagaccaactctat--tacaggaga |
98 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7331411 |
caaaataaaaacatagaaaagcaaggttggcataaaccaaaactaaagcacaaactatttgaattaataacttggaagaccaactctatattacaggaga |
7331510 |
T |
|
| Q |
99 |
gaaaatgaggggtaaggaatggggagaaaaggaaaaaatttaacaagatggggagaacttacatttggattttttaatatggcaaggttgaggttcttcc |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7331511 |
gaaaatgaggggtaaggaagggggagaaaaggaaaaaatttaacaagatggggagaacttacatttggattttttaatatggcaaggttgaggttcttcc |
7331610 |
T |
|
| Q |
199 |
t |
199 |
Q |
| |
|
| |
|
|
| T |
7331611 |
t |
7331611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University