View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20663_low_1 (Length: 629)
Name: NF20663_low_1
Description: NF20663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20663_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 9e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 9e-41
Query Start/End: Original strand, 521 - 618
Target Start/End: Complemental strand, 15084667 - 15084570
Alignment:
| Q |
521 |
ggggacccttgttgacttcacaagtctatgcaaaacattttactaccatatatacctactaatccttattgttaatccttgatactaccacatttcat |
618 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15084667 |
ggggacccttgttgacttcacaagtcaaggcaaaacattttactaccatatatacctaccaatccttattgttaatccttgatactaccacatttcat |
15084570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 34 - 136
Target Start/End: Original strand, 14663497 - 14663599
Alignment:
| Q |
34 |
atgagattttttaggtagttgattaacaattatgtgcagattgcagaaattggcattcatgtaactcttgagaatgtgtctagttcaatatgattgattt |
133 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||| | ||| |
|
|
| T |
14663497 |
atgagcttttttaggtagttacttaacaattctgtgcagattgcagaaattggcattcatgtaactcttgaaaatgtgtctattttaatatgatcgtttt |
14663596 |
T |
 |
| Q |
134 |
aaa |
136 |
Q |
| |
|
||| |
|
|
| T |
14663597 |
aaa |
14663599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 327 - 386
Target Start/End: Complemental strand, 18656864 - 18656805
Alignment:
| Q |
327 |
caattcaactggttatgacttactgcagttaagatatttattttctcacctaatattttt |
386 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
18656864 |
caattcaactggttatgacctacagtagtgaagatttttattttctcacctaacattttt |
18656805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 327 - 386
Target Start/End: Complemental strand, 18689346 - 18689287
Alignment:
| Q |
327 |
caattcaactggttatgacttactgcagttaagatatttattttctcacctaatattttt |
386 |
Q |
| |
|
||||||||||||||||||| ||| | || ||||| ||||||||||||||||| |||||| |
|
|
| T |
18689346 |
caattcaactggttatgacctacagtggtgaagatttttattttctcacctaacattttt |
18689287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University