View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20663_low_5 (Length: 317)
Name: NF20663_low_5
Description: NF20663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20663_low_5 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 27694727 - 27694526
Alignment:
| Q |
1 |
atatatttaatgcatttagattttggataaaaatgtgacgtctaaactcgtgtgtttgctcttgctcacaatagaaactcaattgtgatttttcctgcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694727 |
atatatttaatgcatttagattttggataaaaatgtgacatctaaactcgtgtgtttgctcttgctcacaatagaaactcaattgtgatttttcctgcat |
27694628 |
T |
 |
| Q |
101 |
ggcatgagaatgggaagcatgcaactacttgcttgttggtatactttgtatgtttccatttttaagtctgtaagtcattaaattctacaatgatcagtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
27694627 |
ggcatgagaatgggaagcatgcaactacttgcttgttggtatactttgtatgttttcatttttaagtctgtaagtcattaaattctagagtgatcagtta |
27694528 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
27694527 |
at |
27694526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 27626825 - 27626776
Alignment:
| Q |
75 |
aaactcaattgtgatttttcctgcatggcatgagaatgggaagcatgcaa |
124 |
Q |
| |
|
|||||||||| |||||||| || || ||||||||||||||||||||||| |
|
|
| T |
27626825 |
aaactcaattctgattttttctacagtgcatgagaatgggaagcatgcaa |
27626776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 252 - 301
Target Start/End: Complemental strand, 39637 - 39588
Alignment:
| Q |
252 |
actcaaaagggaattctattaaaaagaagaaatacaattcatatcttttt |
301 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39637 |
actcaaaaaggaaatctattaaaaagaagaaatacaattcatatcttttt |
39588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 252 - 301
Target Start/End: Complemental strand, 30265071 - 30265022
Alignment:
| Q |
252 |
actcaaaagggaattctattaaaaagaagaaatacaattcatatcttttt |
301 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30265071 |
actcaaaagggaattctattagaaagaagaaatacagttcatatcttttt |
30265022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University