View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20664_high_22 (Length: 234)
Name: NF20664_high_22
Description: NF20664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20664_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 50509741 - 50509969
Alignment:
| Q |
1 |
tctcttaatcccaatgtctctgcttctaaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgagcattccgaagggcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50509741 |
tctcttaatcccaatgtctctgcttctaaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgagcattccgaagggcag |
50509840 |
T |
|
| Q |
101 |
tcacataccaattctgaagcnnnnnnnnnnagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggtctggtgctgcactgg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50509841 |
tcacataccaattctgaagcttttttttttagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggtctggtgctgcactgg |
50509940 |
T |
|
| Q |
201 |
accgtgttgttcaccatgattggtcttct |
229 |
Q |
| |
|
||| ||||||||||| ||||||||||||| |
|
|
| T |
50509941 |
accatgttgttcaccctgattggtcttct |
50509969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University