View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20664_low_12 (Length: 364)
Name: NF20664_low_12
Description: NF20664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20664_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 93 - 346
Target Start/End: Complemental strand, 30770726 - 30770473
Alignment:
| Q |
93 |
gagtaatgttacacaaagcataaccaaccataccttgtaactgaatctggtgaaggaagactcacaccaccactagtccttggttgaccaagctgcaatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
30770726 |
gagtaatgttacacaaagcataaccaaccataccttgtaactgaatctggtgatggaagactcacaccaccactagtccttggttgaacaagctgcaacg |
30770627 |
T |
|
| Q |
193 |
gcaaaggcggttttcgagatccgattaatcctccataatctgatctctcatcatcagaaacaaccctattcacattaacatcaccactagtagcagcaac |
292 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30770626 |
gtaaaggaggttttcgagatccgattaatcctccataatctgatctctcatcatcagaaacaaccctattcacattaacatcaccactagtagcagtaac |
30770527 |
T |
|
| Q |
293 |
aactccaccaaaagccattgttgatgttgcaggaattgcagccatagccacatt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770526 |
aactccaccaaaagccattgttgatgttgcaggaattgcagccatagccacatt |
30770473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University