View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20664_low_14 (Length: 350)
Name: NF20664_low_14
Description: NF20664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20664_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 2177646 - 2177318
Alignment:
| Q |
1 |
gagttgttaaccctaattccagcgccaccaaccaaccaaccctagatgtcacataccatcatccattctattttggggcttttggaatctatcatggagg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||| || ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2177646 |
gagttgttaaccctaattcaagcgccaacgaccatcc----ctacctgtcacataccatcatccattctattttggagcttttggaatctatcatggagg |
2177551 |
T |
|
| Q |
101 |
agttggagctagtagagttgatactaagtaagaccatgcaaagaacctcagtatggttgttttgacttgtattcttctctcttgtaactttaattacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177550 |
agttggagctagtagagttgatactaagtaagacgatgcaaagaacctcagtatggttggtttgacttgtattcttctctcttgtaactttaattacttt |
2177451 |
T |
|
| Q |
201 |
gttaaatatctacattgtgactcttttcatgatctatttcatttcattttggtttcttaagctcaccatgagctaaaactttatatagttaaggaacaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177450 |
gttaaatatctacattgtgactcttttcatgatctatttcatttcatttttgtttcttaagctcaccatgagctaaaactttatatagttaaggaacaat |
2177351 |
T |
|
| Q |
301 |
gaggttatagataatgcttgcattttagtatgt |
333 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
2177350 |
gaggttatagttaatgcttgcattttagtatgt |
2177318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University