View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_103 (Length: 277)
Name: NF20665_high_103
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 57 - 253
Target Start/End: Original strand, 10306412 - 10306608
Alignment:
| Q |
57 |
ctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttcat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306412 |
ctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttcat |
10306511 |
T |
 |
| Q |
157 |
caccttcatgctttcactcatgctccgtttccttcaaatccgcataaatcgccgacgtctcctctccgattcaacaccaccgcgatcaccacaacca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10306512 |
caccttcatgctttcactcatgctccgtttccttcaactccgcataaatcgccgacgtctcctctccgattcaacaccaccgcgatcaccaccacca |
10306608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University