View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_111 (Length: 269)
Name: NF20665_high_111
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_111 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 42120466 - 42120204
Alignment:
| Q |
1 |
caaaaacatagttttttccca----gaagtagttctttttgttagaaacgtggggtggnnnnnnnngttctataaaacttttatcacatgttcattgatg |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42120466 |
caaaaacatagttttttcccgtctggaagtagttctttttgttagaaacgtggggtggaaaaaaaagttctataaaacttttatcacatgttcattgatg |
42120367 |
T |
 |
| Q |
97 |
cataagcaggagtttataattacaaagattggtttattccgttgatcaacttttgcttttctaaaccgatcatatttagaaactgatccaaataaaataa |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42120366 |
cataagcaggggtttataattacaaagattggtttattccgttgatcaacttttgcttttctaaaccgatcatatttagaaactgatccaaataaaataa |
42120267 |
T |
 |
| Q |
197 |
cattgaatatgctcttctgatacactaagaagttcaacctttgctttttactagggatctgtg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42120266 |
cattgaatatgctcttctgatacactaagaagttcaacctttgctttttactagggatctgtg |
42120204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University