View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_119 (Length: 258)
Name: NF20665_high_119
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_119 |
 |  |
|
| [»] scaffold0334 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 115 - 239
Target Start/End: Complemental strand, 11177497 - 11177373
Alignment:
| Q |
115 |
ctcaacccgattttattttgcagcacttaccaatccaaattccctttattttcaaagctgctgctacgtcccttttctttcttttatttaattaaattga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177497 |
ctcaacccgattttattttgcagcacttaccaatccaaattccctttattttcaaagctgctgctacgtcccttttctttcttttatttaattaaattga |
11177398 |
T |
 |
| Q |
215 |
attgttgttgcggggctgagcatat |
239 |
Q |
| |
|
||||||||||| |||||||| |||| |
|
|
| T |
11177397 |
attgttgttgctgggctgagtatat |
11177373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 11177600 - 11177567
Alignment:
| Q |
12 |
cagaacctgtgttctattttcgttcagcaatcca |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11177600 |
cagaacctgtgttctattttcgttcagcaatcca |
11177567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 115 - 224
Target Start/End: Original strand, 16469 - 16578
Alignment:
| Q |
115 |
ctcaacccgattttattttgcagcacttaccaatccaaattccctttattttcaaagctgctgctacgtcccttttctttcttttatttaattaaattga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16469 |
ctcaacccgattttattttgcagcacttaccaatccaaattccctttattttcaaagttgctgctacgtcccttttctttcttttatttaattaaattga |
16568 |
T |
 |
| Q |
215 |
attgttgttg |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
16569 |
attgttgttg |
16578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 45
Target Start/End: Original strand, 16366 - 16399
Alignment:
| Q |
12 |
cagaacctgtgttctattttcgttcagcaatcca |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16366 |
cagaacctgtgttctattttcgttcagcaatcca |
16399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University