View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_128 (Length: 253)
Name: NF20665_high_128
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_128 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 94 - 237
Target Start/End: Original strand, 26306698 - 26306841
Alignment:
| Q |
94 |
caaaattttggaggccatcttgatagagctgtttggacctctaaaggccgaccctgcttttaagttgcttcaaatggtagaatcaatggaaagtaagttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26306698 |
caaaattttggaggccatcttgatagagctgtttggacctctaaaggtcgaccctgcttttaagaagcttcaaatggtagaatcaatggaaagtaagttt |
26306797 |
T |
|
| Q |
194 |
tcaactgagaaaatagttgcgttcgtgaaacttcactttacggc |
237 |
Q |
| |
|
|||| |||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
26306798 |
tcaagtgagaaaaaaatcgcgttcgtgaaacttcactttacggc |
26306841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 26306307 - 26306355
Alignment:
| Q |
1 |
ctagacccctcgttactatcttaaatgcatctctcgttattaatatata |
49 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306307 |
ctagaccactcgttactatcttaaatgcatctctcgttattaatatata |
26306355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 240
Target Start/End: Original strand, 4531074 - 4531140
Alignment:
| Q |
174 |
aatcaatggaaagtaagttttcaactgagaaaatagttgcgttcgtgaaacttcactttacggccat |
240 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| || |||||| || ||||||||||||||| ||||||| |
|
|
| T |
4531074 |
aatcaacggaaagtgagttttcaagtgagcaaggagttgcctttgtgaaacttcactttgcggccat |
4531140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 24117934 - 24118001
Alignment:
| Q |
1 |
ctagacccctcgttactatcttaaatgcatctctcgttattaatatatattaagtttttatatgcatt |
68 |
Q |
| |
|
||||||| | ||||||||||| ||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
24117934 |
ctagaccacgcgttactatctgaaatgtatctcgcgttattaatatatattaattttttatatgcatt |
24118001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 240
Target Start/End: Complemental strand, 8733442 - 8733376
Alignment:
| Q |
174 |
aatcaatggaaagtaagttttcaactgagaaaatagttgcgttcgtgaaacttcactttacggccat |
240 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| || |||||| || ||||||||||||||| ||||||| |
|
|
| T |
8733442 |
aatcaacggaaagtgagttttcaagtgagcaaggagttgcctttgtgaaacttcactttgcggccat |
8733376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 240
Target Start/End: Original strand, 19787019 - 19787085
Alignment:
| Q |
174 |
aatcaatggaaagtaagttttcaactgagaaaatagttgcgttcgtgaaacttcactttacggccat |
240 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| || |||||| || ||||||||||||||| ||||||| |
|
|
| T |
19787019 |
aatcaacggaaagtgagttttcaagtgagtaaggagttgcctttgtgaaacttcactttgcggccat |
19787085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 240
Target Start/End: Original strand, 13774390 - 13774456
Alignment:
| Q |
174 |
aatcaatggaaagtaagttttcaactgagaaaatagttgcgttcgtgaaacttcactttacggccat |
240 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| || |||||| || ||||||||||||||| ||||||| |
|
|
| T |
13774390 |
aatcaacggaaagtgagttttcaagtgagcaaggagttgcctttgtgaaacttcactttgcggccat |
13774456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University