View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20665_high_132 (Length: 251)

Name: NF20665_high_132
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20665_high_132
NF20665_high_132
[»] chr2 (1 HSPs)
chr2 (75-236)||(37729437-37729598)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 75 - 236
Target Start/End: Original strand, 37729437 - 37729598
Alignment:
75 catcactctcaagtcgataactttctgtttatcttaaacaacagtaaattagtctaaatagtnnnnnnnntggacccctttcacaagcagtaagaagttc 174  Q
    |||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||        || |||||||| ||||||||||||||||||    
37729437 catcactctcaagtcgatgactttcggtttatcttaaccaacagtaaattagtctaaatagtaagaaaattgaacccctttaacaagcagtaagaagttc 37729536  T
175 gattcatgacccgtgtccaaacaaaatttgattaaagaggagaactcactttgtatactcac 236  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||    
37729537 gattcatgacccgtgtccaaacaaaatttaattaaagaggagaactcactttatatactcac 37729598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University