View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_132 (Length: 251)
Name: NF20665_high_132
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_132 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 75 - 236
Target Start/End: Original strand, 37729437 - 37729598
Alignment:
| Q |
75 |
catcactctcaagtcgataactttctgtttatcttaaacaacagtaaattagtctaaatagtnnnnnnnntggacccctttcacaagcagtaagaagttc |
174 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
37729437 |
catcactctcaagtcgatgactttcggtttatcttaaccaacagtaaattagtctaaatagtaagaaaattgaacccctttaacaagcagtaagaagttc |
37729536 |
T |
|
| Q |
175 |
gattcatgacccgtgtccaaacaaaatttgattaaagaggagaactcactttgtatactcac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
37729537 |
gattcatgacccgtgtccaaacaaaatttaattaaagaggagaactcactttatatactcac |
37729598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University