View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_136 (Length: 251)
Name: NF20665_high_136
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_136 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 50994076 - 50994319
Alignment:
| Q |
1 |
ttgcaaatgctcttgggagaattgctgataaattgtaaggttggatcgtaggtttagagttagttaacatttcgagtcaacaatagtcgatcccttcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
50994076 |
ttgcaaatgctcttgggagaattgctgataaattgtaaggttggatcgtaggtttagagttagttaacatttcgagtcaacaatagtgggtcccttcatt |
50994175 |
T |
 |
| Q |
101 |
atttttcagtcacattttgcc------nnnnnnnnnnnagtgttattttgattattatactatgtcaccattaaacatttctcccattatatgtttgttt |
194 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50994176 |
atttttcactcacattttgcccttttttttttttttttagtgttattttgattattatactatgtcaccattaaacatttctcccattatatgtttgttt |
50994275 |
T |
 |
| Q |
195 |
tattagttgttcaggatcatgatggtaaggtcactaaagtgttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50994276 |
tattagttgttcaggatcatgatggtaaggtcactaaagtgttc |
50994319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University