View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_142 (Length: 250)
Name: NF20665_high_142
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_142 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 46147145 - 46146900
Alignment:
| Q |
13 |
aatattagggactatccatgggaaagatacaccttgaaagagttgcttcgtgcaacaaacaactttcatcaagataacaagattggagaaggtggatttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46147145 |
aatattagggactatccatgggaaagatacaccttgaaagagttgcttcgtgcaacaaacaactttcatcaagataacaagattggagaaggtggatttg |
46147046 |
T |
|
| Q |
113 |
gaagtgtatattggggtcaaacaagtaaaggcgtcgaggtaattaaatt---------------ttgattannnnnnnnnagacaaatattagtaagtta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
46147045 |
gaagtgtatattggggtcaaacaagtaaaggcgtcgaggtaattaaattttatcccgttaaattttgattttttttttttagacaaatattagtaagtta |
46146946 |
T |
|
| Q |
198 |
gtagttgtattagttttctagatcgaattcaaaaccttatgcttaa |
243 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46146945 |
gtagttgtattagttttcgagatcgaattcaaaaccttatgcttaa |
46146900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University