View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_150 (Length: 248)
Name: NF20665_high_150
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_150 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 242
Target Start/End: Complemental strand, 2470662 - 2470424
Alignment:
| Q |
5 |
gtttgctcttggtggtttagaagtcctttctttgtcagcatatattgtaattctggaaaggcatgcttgactcatattttttattttagcaatcttttct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2470662 |
gtttgctcttggtggtttagaagtcctttctttgtcagcatatattgtaattctggaaaggcatgcttgactcatattttttattttagcaatcttttct |
2470563 |
T |
 |
| Q |
105 |
gttc-ttgggactgttggtggaaggaaaaaatgttctagaaacttatcctcaaagtaaaatggactattaaaataatcttataataattatgagtaattt |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2470562 |
gttcattgggactgttggtggaaggaaaaaatgttctagaaacttatcctcgaagtaaaatggactattaaaataatcttataataattatgagtaattt |
2470463 |
T |
 |
| Q |
204 |
gaacaataatattctgtttttcatctcaattagtataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2470462 |
gaacaataatattctgtttttcatctcaattagtataat |
2470424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University