View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_169 (Length: 239)
Name: NF20665_high_169
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_169 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 30809061 - 30809270
Alignment:
| Q |
15 |
gggagggttctgactagatggacacgtatatggttggatctgtgtgtcccaaactcgggtaacagacnnnnnnnnaccttcatagtttccaacttttcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30809061 |
gggagggttctgactagatggacacgtatatggttggatctgtgtgtcccaaactcgggtaacagacttttttttaccttcatagtttccaacttttcat |
30809160 |
T |
|
| Q |
115 |
atatattctcgaaagnnnnnnnnattcatgaaggaacgacaacaaactgcctgaatggcaaaaataatcttcatagatattgtatttataaatctaaaag |
214 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809161 |
atatattctctaaagttttttttattcatgaaggaacgacaacaaactgcctgaatggcaaaaataatcttcatagatattgtatttataaatctaaaag |
30809260 |
T |
|
| Q |
215 |
acatggtatt |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
30809261 |
acatggtatt |
30809270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 30820847 - 30820895
Alignment:
| Q |
30 |
agatggacacgtatatggttggatctgtgtgtcccaaactcgggtaaca |
78 |
Q |
| |
|
||||||| |||| || | ||||||||| ||||||||||||||||||||| |
|
|
| T |
30820847 |
agatggatacgtgtacgcttggatctgagtgtcccaaactcgggtaaca |
30820895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University