View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_173 (Length: 238)
Name: NF20665_high_173
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_173 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46146846 - 46146628
Alignment:
| Q |
1 |
tttagagtttcttttgttgatgataaactctaaggtatgagagatattttttgtgacacttatgatgcnnnnnnnnnggctaatgaatggaacatatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46146846 |
tttagagtttcttttgttgatgataaactctaaggtatgaga--tattttttgtgacacttatgatgcaaaaaat--ggctaatgaatggaacatatgta |
46146751 |
T |
|
| Q |
101 |
tgtagattgctgtgaagcggttgaagacaatgactgcaaaagcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146750 |
tgtagattgctgtgaagcggttgaagacaatgactgcaaaagcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaattt |
46146651 |
T |
|
| Q |
201 |
gttaggattgagggggttctatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46146650 |
gttaggattgagggggttctatg |
46146628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 206
Target Start/End: Complemental strand, 53682821 - 53682752
Alignment:
| Q |
137 |
caaaagcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttagg |
206 |
Q |
| |
|
|||| ||||||||||||||||| || ||||| ||||| || |||||||| ||||| || ||||||||||| |
|
|
| T |
53682821 |
caaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttagg |
53682752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University