View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_181 (Length: 236)
Name: NF20665_high_181
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_181 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 34660067 - 34659856
Alignment:
| Q |
1 |
atgtattacacgagtaataatcttttatatatctaatctaatctaatctggaaaacactggaaaagtacattagttatgttttagattggtgccttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34660067 |
atgtattacacgagtaataatcttttatatatctaatctaatct-----ggaaaacactggaaaagtactttagttatgttttagattggtgccttttct |
34659973 |
T |
 |
| Q |
101 |
tttgggtacaaattagtgctttattcccacaaattatgattttttatggttgttgctaagttttgtgtatggattgccttattccctcgccctttccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34659972 |
tttgggtacaaattagtgctttattcccacaaattatgattttttatggttgttgctaagttttgtgtatggattgccttattccctcgccctttccttt |
34659873 |
T |
 |
| Q |
201 |
atgttataatcatcata |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34659872 |
atgttataatcatcata |
34659856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University