View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_182 (Length: 236)
Name: NF20665_high_182
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_182 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 32950988 - 32951200
Alignment:
| Q |
16 |
ctttcttcattttttcttcggctctatgcttttgatattcagccttcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaac |
115 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950988 |
ctttcttcattttttcttcagctctctgcttttggtattcagccatcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaac |
32951087 |
T |
 |
| Q |
116 |
ttcagccaattcctcctcttcaggtttcgtcattctgtcctcactctccttttgaatgaattccttcttctcttcagctttccttgttctttcttcagcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32951088 |
ttcagccaattcctcctcttcaggtttcgtcattctgtcctcactctccttttgaatgaattccttcttctcttcagctttccttgttctttcttcagcc |
32951187 |
T |
 |
| Q |
216 |
ctcctctctgctc |
228 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
32951188 |
ctcctctcagctc |
32951200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University