View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_186 (Length: 235)
Name: NF20665_high_186
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_186 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 21781920 - 21782140
Alignment:
| Q |
1 |
agcaccggttcgaaccatgttcggttttgaaatcgaaccacaattcaacgaaccttatttgtccacgtcgcttcaagacttttggggtcgtaggtggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21781920 |
agcaccggttcgaaccatgttcggttttgaaatcgaaccacaattcaacgaaccttatttgtccacatcgcttcaagacttttggggtcgtaggtggaac |
21782019 |
T |
|
| Q |
101 |
ctaatggtaactggtatcttacgccccatcgtatacaatcctgttcgccacatcattaggtcttatgtgggttccacatatgccacttcagctgccacgt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21782020 |
ctaatggtaactggtatcttacgtcccaccgtatacaatcccgttcgccacatcattaggtcttatgtgggttccacatatgccacttcagctgccacat |
21782119 |
T |
|
| Q |
201 |
tggcaacttttgtggtgtctg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21782120 |
tggcaacttttgtggtgtctg |
21782140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University