View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_197 (Length: 223)
Name: NF20665_high_197
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_197 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 3855531 - 3855702
Alignment:
| Q |
18 |
agatcgacatgatcaacaaacccattgactacagggtgaagccaacgaagcaacgaggcagagttgcaaaagcaagacgcagacaaaagagttaacgttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3855531 |
agatcgacatgatcaacaaacccattgactacagggtgaagccaacgaagcaacgaggcagagttgcaaaagcaagacgcagacaaaagagttaatgttt |
3855630 |
T |
 |
| Q |
118 |
tgataggaggctgtctgtcaaagataaaggacttcgccattgatatataaagattataggcgtcttggtcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3855631 |
tgataggaggctgtctgtcaaagataaaggacttcgccattgatatataaagattataggcgtcttgttcat |
3855702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 69 - 137
Target Start/End: Complemental strand, 4141041 - 4140973
Alignment:
| Q |
69 |
aacgaggcagagttgcaaaagcaagacgcagacaaaagagttaacgttttgataggaggctgtctgtca |
137 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4141041 |
aacgaggcagagttgcagaagcgagacgcggacaaaagagttaatgttttgataggtagctgtctgtca |
4140973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University