View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_43 (Length: 410)
Name: NF20665_high_43
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 171 - 394
Target Start/End: Complemental strand, 34532133 - 34531910
Alignment:
| Q |
171 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacctaccgacgagttggtcggtt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532133 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacctaccgacgagttggtcggtt |
34532034 |
T |
|
| Q |
271 |
ctttgttcaactggttgaaccgatctgttcaattttaaaacattagtatattgtgatggttaacttggttttcatattcattcaggggtttcatagcaac |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532033 |
ctttgttcaactggttgaaccgatctgttcaattttaaaacattagtatattgtgatggttaacttggttttcatattcattcaggggtttcatagcaac |
34531934 |
T |
|
| Q |
371 |
tgcacctgaggctggtcaactaat |
394 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34531933 |
tgcacctgaggctggtcaactaat |
34531910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 34532295 - 34532176
Alignment:
| Q |
10 |
attattctatcttctgcaatgttttgaaattcggaccgaatatggacc-agtgaaacttcaagattatgatttaataggttcaatcagttcaacttcggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34532295 |
attattctatcttctgcaatgttttgaaattcggaccgaatatggaactagtgaaacttcaagattatgatttaataggttcaatcagttcaactacggt |
34532196 |
T |
|
| Q |
109 |
taaactggatgacagataga |
128 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
34532195 |
taaactggacgacagataga |
34532176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University