View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_54 (Length: 375)
Name: NF20665_high_54
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 41 - 256
Target Start/End: Original strand, 22304072 - 22304305
Alignment:
| Q |
41 |
ttattaatttctccaaccattttattttgcattcgattaatcttctatttggtcatttttgtaattggctttattgtttggactataatagagatctttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
22304072 |
ttattaatttctccaaccattttattttgcattcgattaatcttctatttggtcatttttgtaattggctttattgtttgggcaataatagagatctttt |
22304171 |
T |
 |
| Q |
141 |
agaaactc------------------aagttaaaaatagttttgtccaataataactgccacaacttcctgaaaaccttggtggttccattaatgaacca |
222 |
Q |
| |
|
|||||| | | || |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22304172 |
agaaacactataatgcaaatgtacaaaggtaaaaaatagctttgtccaataataactgccacaacttactgaaaaccttggtggttccattaatgaacca |
22304271 |
T |
 |
| Q |
223 |
tgggattgaatgaatcaaaaagtatataatatac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22304272 |
tgggattgaatgaatcaaaaagtatataatatac |
22304305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 356
Target Start/End: Original strand, 22255634 - 22255711
Alignment:
| Q |
279 |
ggaaatctttttccaccataggagagtttattttgaccatttgattaatgaggagcatagatgctatgatggtctgtc |
356 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| ||||| |||| |||||| |||||||| | || |||||||||||||| |
|
|
| T |
22255634 |
ggaaagctttttccaccatgggaaagttttttttggtcattagattaaagaggagcacatattttatgatggtctgtc |
22255711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University