View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_high_80 (Length: 320)
Name: NF20665_high_80
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_high_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 16 - 316
Target Start/End: Original strand, 4393800 - 4394100
Alignment:
| Q |
16 |
tcttccaccaccacaagtaactgcaccaactaccgagactttcttcttcccggtgcaacatcatggacaaggaatagtgcttcctaacaatgttacatca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4393800 |
tcttccaccaccacaagtaactgcaccaactactgagactttcttcttcccggtgcaacatcatggacaaggaatagtgcttcctaataatgttacatca |
4393899 |
T |
 |
| Q |
116 |
caagggttttgcttctctgaactttccaacatggttcctgctcaatcacatggtcagcaacaccataacactggtaattgcactaccagtttcctgctta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4393900 |
caagggttttgcttctctgaactttccaacatggttcctgctcaatcacatggtcagcaacaccataacactggtaattgcactaccagtttcctgctta |
4393999 |
T |
 |
| Q |
216 |
gtgagatcatgaacaaccatggtgttaattcctcaaagaaagatcaagaacaggataagtccgtgaaaataatgcaccaaatccccccacatctgaacat |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394000 |
gtgagatcatgaacaaccatggtgttaattcctcaaagaaagatcaagaacaggataagtctgtgaaaataatgcaccaaatccccccacatctgaacat |
4394099 |
T |
 |
| Q |
316 |
c |
316 |
Q |
| |
|
| |
|
|
| T |
4394100 |
c |
4394100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University