View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_100 (Length: 285)
Name: NF20665_low_100
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 46556818 - 46556909
Alignment:
| Q |
19 |
accaccttcggtagcagcaacaacaaccttaacagcttcgttttcgttgccaccatcggtttggttaccttcatcactgctttctccatcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556818 |
accaccttcggtagcagcaacaacaaccttaacagcttcgttttcgttgccaccatcggtttggttaccttcatcactgctttctccatcac |
46556909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 187 - 280
Target Start/End: Original strand, 46556986 - 46557079
Alignment:
| Q |
187 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttgcttct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46556986 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttct |
46557079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University