View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_110 (Length: 272)
Name: NF20665_low_110
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_110 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 5843649 - 5843461
Alignment:
| Q |
9 |
agcagagatattatctagaagcttctagagg-ttctcacttcttacccctccccttgagaggtgtcatcacaaagtccttgaagtgttgaggtttgacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5843649 |
agcagagatattatctagaagcttctagagggttctcacttcttacccctccccttgggaggtgtcatcacaaagtccttgaagcgttgaggtttgacca |
5843550 |
T |
|
| Q |
108 |
agttcctcttagcccttagttttggaaccagctcttcttcttcatagtgtccaatatcctcctcttggttatcatcctcatccataaca |
196 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5843549 |
agtttctcttagcccttagtttaggaaccagctcttcttctccatagtgtccaatatcctcctcttggttattatcctcatccataaca |
5843461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 5849685 - 5849497
Alignment:
| Q |
9 |
agcagagatattatctagaagcttctagagg-ttctcacttcttacccctccccttgagaggtgtcatcacaaagtccttgaagtgttgaggtttgacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5849685 |
agcagagatattatctagaagcttctagagggttctcacttcttacccctccccttgggaggtgtcatcacaaagtccttgaagcgttgaggtttgacca |
5849586 |
T |
|
| Q |
108 |
agttcctcttagcccttagttttggaaccagctcttcttcttcatagtgtccaatatcctcctcttggttatcatcctcatccataaca |
196 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5849585 |
agtttctcttagcccttagtttaggaaccaactcttcttctccatagtgtccaatatcctcctcttggttattatcctcatccataaca |
5849497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 32605255 - 32605194
Alignment:
| Q |
195 |
cagcaatggtgtgtggtttccgaaagacatagacaatggttcggcaactaaatttggtgatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
32605255 |
cagcaatggtgtgtggtttccgaaagacatagacaatggttcggtaactaaatttggcgatg |
32605194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University