View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_127 (Length: 254)
Name: NF20665_low_127
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_127 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 237
Target Start/End: Original strand, 54733057 - 54733288
Alignment:
| Q |
6 |
gtcgaagaatatacgatggatgcatggtgaaattctctgaaaaagagagtataaagagtgaagatgataacaaaatgaagttggaagagaaacaggagat |
105 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733057 |
gtcgtagaataaacgatggatgcatggtgaaattctctcaaaaagagagtataaagagtgaagatgataacaaaatgaagttggaagagaaacaggagat |
54733156 |
T |
|
| Q |
106 |
aaaaacagagatgggtttggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733157 |
aaaaacagagatgggtttggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaaga |
54733256 |
T |
|
| Q |
206 |
gtgttgcaaaggtgtgagagtgataatgataa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54733257 |
gtgttgcaaaggtgtgagagtgataatgataa |
54733288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University